pkgdown/extra.css

Skip to contents

TIRTLseq text file data structure

TIRTLseq data is kept in tab-separated text files (.tsv). The files may be ‘gzipped’ (.tsv.gz) to save space.

Output for each sample consists of 3 files:

  • <sample-name>_TIRTLoutput.tsv(.gz)– Paired TCRs – a table of computationally paired alpha/beta TCRs
  • <sample-name>_pseudobulk_TRA.tsv(.gz) – Alpha chain “pseudo-bulk” data – a table of read count summary metrics for alpha-chains across all wells on a plate
  • <sample-name>_pseudobulk_TRB.tsv(.gz) – Beta chain “pseudo-bulk” data – a table of read count summary metrics for beta-chains across all wells on a plate

Loading TIRTLseq Data in R

The load_tirtlseq() function loads paired TCR TIRTLseq data from all text files in a directory.

The function can also automatically assemble a metadata table if the files are named in a way that specifies the sample metadata.

Here, our files are named (marker)_(timepoint)_(version)_ ... .tsv.gz, e.g. cd8_tp1_v2_TIRTLoutput.tsv.

## Error in system("nvidia-smi", intern = TRUE, ignore.stderr = TRUE) : 
##   error in running command
library(dplyr)
library(rmarkdown)
folder = system.file("extdata/SJTRC_TIRTLseq_minimal", package = "TIRTLtools")
dir(folder)
## [1] "cd8_tp1_v2_pseudobulk_TRA.tsv.gz" "cd8_tp1_v2_pseudobulk_TRB.tsv.gz"
## [3] "cd8_tp1_v2_TIRTLoutput.tsv.gz"    "cd8_tp2_v2_pseudobulk_TRA.tsv.gz"
## [5] "cd8_tp2_v2_pseudobulk_TRB.tsv.gz" "cd8_tp2_v2_TIRTLoutput.tsv.gz"
ts_data = load_tirtlseq(folder, meta_columns = c("marker", "timepoint", "version"), sep = "_")
## 16.456 sec elapsed
## these files are named (marker)_(timepoint)_(version)_etc.tsv.gz

The TIRTLseq data object

In R, TIRTLseq data is stored in a “list” which can contain any type of unstructured data.

The list contains two slots.

  • meta - a data frame with sample metadata
  • data - a list with data for each sample
class(ts_data) ## list
## [1] "list"
names(ts_data) ## [1] "data" "meta"
## [1] "data" "meta"

The metadata table

The $meta slot contains a data frame with columns for sample_id (determined from the filename) and any columns you specified with the “meta_columns” argument. The label column combines all of the metadata columns into one string.

If you did not specify “meta_columns” in the load_tirtlseq() call, then the table will only contain the sample_id and label columns.

class(ts_data$meta) ## data.frame
## [1] "tbl_df"     "tbl"        "data.frame"
ts_data$meta %>%
  mutate(label = paste(substr(label, 0, 20), "...", sep = "")) %>%
  paged_table()

The data list

The $data slot is also a “list” that contains one object for each sample, named by its sample_id.

For each sample, $data$<sample-name> is a “list” of three data frames.

  • $data$<sample-name>$alpha contains the pseudo-bulk data for the alpha chain
  • $data$<sample-name>$beta contains the pseudo-bulk data for the beta chain
  • $data$<sample-name>$paired contains alpha and beta chains that were paired computationally by our MAD-HYPE and T-SHELL algorithms.
class(ts_data$data) ## list
## [1] "list"
names(ts_data$data) ## [1] "cd8_tp1_v2" "cd8_tp2_v2"
## [1] "cd8_tp1_v2" "cd8_tp2_v2"
class(ts_data$data$cd8_tp1_v2) ## list
## [1] "list"
names(ts_data$data$cd8_tp1_v2) ## [1] "alpha"  "beta"   "paired"
## [1] "alpha"  "beta"   "paired"

The pseudo-bulk data frames

In the TIRTLseq assay, one experiment is repeated hundreds of times in a multi-well plate. Generally, an experiment is repeated in a half plate (192 wells) or a whole plate (384 wells). Alpha and beta TCRs are sequenced simultaneously, but separately in each well.

The reads for each well are processed using MiXCR, which calls V and J segments, assembles the CDR3 nucleotide sequence, and generates its corresponding amino acid sequence.

For each clonotype defined by a unique CDR3 nucleotide sequence, the following are reported:

Read identifying information
  • targetSequences - CDR3 nucleotide sequence
  • v - V-segment call from MiXCR
  • j - J-segment call from MiXCR
  • aaSeqCDR3 - CDR3 amino acid sequence, including stop codons (*) and frameshifts (_)
Read count summary metrics
  • readCount - sum of read counts over all wells for the clonotype
  • readFraction - the fraction of all reads attributed to the clonotype
  • sem - standard error of the mean for the read fraction.
  • n_wells - the number of wells in which a clonotype is observed
  • max_wells - the number of wells used for the experiment (generally the same for all clonotypes)
  • readCount_max - the maximum read count in any well for the clonotype
  • readCount_median - the median read count for a clonotype

$data$<sample-name>$alpha and $data$<sample-name>$beta contain the pseudo-bulk data for alpha and beta chains, respectively.

ts_data$data$cd8_tp1_v2$alpha %>%
  mutate(targetSequences = paste(substr(targetSequences, 0, 20), "...", sep = "")) %>%
  paged_table()
ts_data$data$cd8_tp1_v2$beta %>%
  mutate(targetSequences = paste(substr(targetSequences, 0, 20), "...", sep = "")) %>%
  paged_table()

The paired data frame

We use computational algorithms based on occurrence patterns (MAD-HYPE algorithm) or correlation of read fractions (T-SHELL) of TCR chains across all wells to identify alpha and beta chains present in the same clone.

In general, the MAD-HYPE method works well for moderately frequent clones, but fails for the most frequent clones if they are found in all or almost all wells. The T-SHELL algorithm works well for pairing these very frequent clones.

For each pair, we report:

V/J/CDR3 sequences
  • alpha_nuc_seq, alpha_nuc - alpha CDR3 nucleotide sequence
  • beta_nuc_seq, beta_nuc - beta CDR3 nucleotide sequence
  • alpha_beta - alpha-beta pair concatenated nucleotide sequence
  • cdr3a - alpha CDR3 amino acid sequence
  • va - alpha V gene
  • ja - alpha J gene
  • cdr3b - beta CDR3 amino acid sequence
  • vb - beta V gene
  • jb - beta J gene
Alpha/beta chain occurence and overlap
  • wa - number of wells where alpha is found
  • wb - number of wells where beta is found
  • wi - number of wells where alpha is found, but not beta
  • wj - number of wells where beta is found, but not alpha
  • wij - number of wells where both alpha and beta are found
Pairing method scores and metrics
  • method - method that resulted in pairing: T-SHELL or MAD-HYPE
  • r - for T-SHELL, the Pearson correlation coefficient between alpha and beta chain frequencies
  • ts - for T-SHELL, the t-statistic of the correlation
  • pval - for T-SHELL, the p-value of the correlation
  • pval_adj - for T-SHELL, the adjusted p-value of the correlation
  • score - for MAD-HYPE, the score of the pairing (higher is better)
  • loss_a_frac - the fraction of wells with lost alpha chain
  • loss_b_frac - the fraction of wells with lost beta chain
ts_data$data$cd8_tp1_v2$paired %>%
  mutate(alpha_nuc = paste(substr(alpha_nuc, 0, 20), "...", sep = ""),
         beta_nuc = paste(substr(beta_nuc, 0, 20), "...", sep = "")
         ) %>%
  paged_table()

Note: If a TCR pair is paired by both algorithms, it will be listed twice in the $paired data frame, once for the “MAD-HYPE” method and once for the “T-SHELL” method.

## example TCR pair with two entries, one for each pairing algorithm
ts_data$data$cd8_tp1_v2$paired %>% 
  filter(alpha_beta == "TGTGTGAGAGCCGGAGGCTTCAAAACTATCTTT_TGCAGTGCTACATCTCGGAGAGAGCCCTACGAGCAGTACTTC") %>%
  select(alpha_nuc, beta_nuc, method, everything()) %>%
  paged_table()

To see only unique TCR pairs, you may do the following:

pairs = ts_data$data$cd8_tp1_v2$paired
pairs_unique = pairs[!duplicated(pairs$alpha_beta),]

pairs_unique %>%
  mutate(alpha_nuc = paste(substr(alpha_nuc, 0, 20), "...", sep = ""),
         beta_nuc = paste(substr(beta_nuc, 0, 20), "...", sep = "")) %>%
  paged_table()
nrow(pairs) ## ~20k TCR pairs called by one or both methods
## [1] 20690
nrow(pairs_unique) ## ~14k unique TCR pairs called
## [1] 14273